Home | Volume 4

The peculiar organization of telomeres in Drosophila melanogaster

Dr. , Sergio Pimpinelli et. al.

Download as PDF : _01FC Pimpinelli 1-10.pdf : 2028710 bytes


Previous Article: Molecular mechanisms that regulate hyaluronan synthesis
Next Article: Somatic cell nuclear transfer as a tool for investigating ageing processes in mammals

Gene Therapy and Molecular Biology Vol 4, page 1

Gene Ther Mol Biol Vol 4, 1-10. December 1999.

The peculiar organization of telomeres in Drosophila melanogaster

Review Article

Laura Fanti1, 2 and Sergio Pimpinelli2

1 Istituto di Genetica, Università di Bari, 70126 Bari, Italy; 2 Istituto Pasteur, Fondazione Cenci Bolognetti and Dipartimento di

Genetica e Biologia molecolare, Università “La Sapienza”, 00185 Roma, Italy

Correspondence: Sergio Pimpinelli, Dipartimento di Genetica e Biologia molecolare, Università di Roma “La Sapienza” Piazzale Aldo

Moro, 500185 Roma, Italy; Tel. 39-06-49912876; Fax. 39-06-4456866; E-mail: pimpinelli@axcasp.caspur.it

Abbreviations: HP1, Heterochromatin Protein 1; TPE, telomere position effects; hTRT, human telomerase reverse transcriptase subunit;

TAS, Telomere Associated Sequences; ORF, open reading frame; LBR, lamin B receptor; LTR, long terminal repeat

Key Words: Telomeres, Drosophila melanogaster, telomerase, HeT-A, TART, heterochromatin protein, 1 (HP1), telomere capping

Received: 21 August 1999; accepted: 4 September 1999

Summary

Telomeres are specialized DNA-protein complexes at the ends of eukaryotic chromosomes. They protect the chromosome extremities by preventing potential chromosome damages such as loss of terminal sequences during chromosome replication and by preventing chromosome fusions and degradation. The telomeres of most organisms contain short terminal GC-rich repeats due to the activity of telomerase, a ribonucleoprotein DNA polymerase. Telomeres have gained an exceptional widespread interest in human biology because of their involvement in aging and carcinogenic processes. Despite the fact that the telomere concept was elaborated in Drosophila melanogaster, this organism lacks telomerase and its telomeres are dramatically different from those in other organisms. Telomere loss in Drosophila is prevented by two specific non-LTR transposons, called HeT-A and TART, that appear to be dispensable for chromosome stability. Recent studies have permitted to isolate proteins involved in telomere stability in Drosophila. In particular it has been shown that the heterochromatin protein 1 (HP1) plays an essential role in telomere capping. HP1 is of a special interest because it is a highly conserved protein; HP1 homologues have been identified in many different organisms. Most important, three HP1-like proteins have been found in humans. Future studies will tell us if some of the human HP1 proteins have conserved a functional telomeric localization as in Drosophila.

I. Introduction

Telomeres are specialized terminal structures in linear chromosomes that are essential for the stability of eukaryotic genomes (for review see Biessmann and Mason, 1992; Zakian, 1995, 1996). The telomere concept was elaborated for the first time by Muller (l938, 1940) to explain his failure to recover terminally deleted chromosomes after X-irradiation in Drosophila. He observed that the recovered broken chromosomes were always capped by other chromosome fragments. Experiments performed by Barbara McClintock provided a strong support to the telomere concept; she showed that, in maize, chromosomes that lack a telomere fuse, generate a dicentric bridge during mitosis and initiate a chromosome breakage-fusion-bridge cycle (McClintock, 1941).
Telomeres protect the extremities of chromosomes by preventing loss of terminal sequences during DNA replication thus preventing chromosome fusions and degradation.
The dynamic spatial order of chromosomes during mitotic and meiotic cycles is also determined by telomeres, by their interaction with both the nuclear envelope and nuclear matrix (reviewed in Dernburg et al. 1996). Moreover, telomeres show a peculiar genetic effect on gene expression called telomere position effects (TPE) (Hazelrigg et al., 1984; Levis et al., 1985; see also Sandell and Zakian, 1992 and Shore, 1996 for reviews).
The telomeres of eukaryotes are usually composed of conserved, short, tandemly-repeated, GC-rich sequences (see Henderson, 1995 for review) (see Table 1).
1

Fanti and Pimpinelli: Organization of telomeres in Drosophila

Table 1. Telomeric Repeat Sequences in Eukaryotes

Group Organism Telomeric sequence

Vertebrates

Human, mouse, Xenopus

TTAGGG

Insects

Bombyx mori

TTAGG

Nematodes

Ascaris lumbricoides, C. elegans

TTAGGC

Higher plants

Parascaris univalens

TTGCA

Arabidopsis

TTTAGGG

Algae Chlamydomonas TTTTAGGG

Ciliates

Tetrahymena, Glaucoma

TTGGGG

Paramecium TTGGG(T/G)

Oxytricha, Stylonychia, Euplotes

TTTTGGGG

Slime molds Physarum, Didymium TTAGGG

Dictyostelium

AG(1-8)

Flagellates Trypanosoma, Crithidia

TTAGGG

Sporozoan

Plasmodium

TTAGGG(T/C)

Filamentous fungi

Neurospora

TTAGGG

Fission yeasts

Schizosaccharomyces pombe

TTAC(A)(C)G(1-8)

Budding yeasts

Saccharomyces cerevisiae

G(2-3)(TG)(1-6)T (consensus)

Candida glabrata

GGGGTCTGGGTGCTG

Candida albicans GGTGTACGGATGTCTAACTTCTT

Candida tropicalis

GGTGTA[C/A]GGATGTCACGATCATT

Candida maltosa GGTGTACGGATGCAGACTCGCTT

Candida guillermondii

GGTGTAC

Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT

Kluyveromyces lactis

GGTGTACGGATTTGATTAGGTATGT

This sequence conservation is due to a common mechanism for telomere synthesis that involves the telomerase, a ribonucleoprotein DNA polymerase. This enzyme prevents the shortening of terminal sequences at every replication round by adding short, tandem, GC-rich sequences onto the chromosome end (for review see Greider, 1995) (Figure 1). The telomeric tandem repeats seem to be also essential for chromosome stability. In yeast, for example, chromosomes lacking telomeric DNA are lost (Sandell and Zakian, 1993). Thus, besides the telomere replication function, the DNA telomeric sequences also play an essential role in capping functions in organisms with telomerase activity.
Along with telomeric DNA sequences and telomerase, several other proteins involved in telomere metabolism have been isolated in different organisms. Different classes of proteins have been characterized in terms of their interaction with telomeric DNA or with other proteins. From a functional point of view, such proteins could be differentially involved in telomere
capping and, thus, in chromosome stability. Moreover, there are also proteins involved in chromosome orientation, nuclear architecture and in telomere gene silencing (see Fang and Cech for review). However, only recently, it has been reported a clear example of chromosome fusion induced by a dominant negative allele of the human telomeric DNA-binding TRF2 protein demonstrating that this protein is required for the protection of telomeric ends (van Steensel et al., 1998).
Recently, telomeres have gained an exceptionally widespread interest in human biology and biomedicine. Based on different sets of data, not always concordant, there is an intense debate about the involvement of telomeres in cell aging and carcinogenic processes in humans (see Harley,
1995; de Lange, 1995, 1998 for reviews). The telomere hypothesis of aging and immortalization (see Figure 2 for a schematic model) assigns a significant role of telomere
shortening as a cause of cellular senescence. Specifically, the maintenance of the length of telomere sequences could be involved in the process of cell immortalization and, hence, in carcinogenesis.
2

Gene Therapy and Molecular Biology Vol 4, page 3

Figure 1. Mechanism of telomere elongation by telomerase which resolves the end-replication problem. After removal of RNA primers and ligation of the Okazaki fragments, an unreplicated region on the lagging-strand is led. De novo elongation of the leading-strand by telomerase permits the terminal gap on the lagging-strand to be filled by the conventional replication mechanism.

Several lines of compelling evidence support this view. It has been shown that telomerase activity is present in germ cells, although it is not detectable in various somatic cell types. As a consequence, the somatic chromosomes progressively lose telomeric DNA sequences at any replicative round. This telomere loss eventually leads to a permanent cell cycle arrest, probably due to a checkpoint mechanism that recognizes the damaged DNA at the chromosome extremities. In contrast, in immortalized or cancerous cells the telomerase results are usually reactivated and the telomeres are maintained (see Harley,
1995; Autexier and Greider, 1996; Shay and Bacchetti,
1997 for reviews). Most recently, a decisive support for the biological role of telomere loss in human cell aging has been provided by Bodnar et al. (1998). Since all the telomerase subunits in human somatic cells are present except for that of the reverse transcriptase subunit (hTRT), telomerase activity was induced in different somatic cells by transfecting the hTRT subunit and examined the cells’ proliferative potential. The results showed that the activation of telomerase-induced telomere elongation coincides with a strong increase in proliferative potential. These cells, instead of senescing after a defined number of
divisions, continue to divide, showing normal karyotypes and youthful phenotypes. The implications of these findings in carcinogenesis are also significant. They suggest, in fact, that telomerase-dependent immortalization is probably required for tumour progression, and that telomerase silencing could be an essential component of a tumour suppressor system.

II. The peculiarity of Drosophila

telomeres

Despite the fact that telomeres were discovered in Drosophila, Drosophila telomeres are dramatically different from those in other organisms regarding at least the replication functions. Several studies have shown that Drosophila lacks telomerase and that peculiar transposable elements seem to act as buffers against telomere loss during DNA replication. In addition, these elements are not involved in chromosome stability thus suggesting that replicating functions and telomere capping should be separate. The recent discovery that HP1 functions as a telomeric "cap" protein give support to the view that telomere stability in Drosophila mainly, if not exclusively, depends on specific proteins.
3

Fanti and Pimpinelli: Organization of telomeres in Drosophila

Figure 2. The model of telomere function in cell aging and immortalization. Telomerase activity maintains the telomeres in germ line cells. In somatic cells telomerase is inactive, and, consequently, the telomeres of some chromosome become shorter, leading to a cell cycle arrest (Hayflick limit) (Hayflick, 1965). Somatic cells can, however, bypass the cell cycle arrest by transformation events. In this case, the cells eventually have the majority of their chromosomes with critically short telomeres and enter crisis. Some clones reactivate telomerase and become immortal, acquiring the capacity to grow indefinitely.

Figure 3. The molecular structure of the RNA transposition intermediate of Drosophila HeT-A and TART telomeric retrotransposons. The 3' and 5' ends are shown in blue. The ORFs correspond to the differently colored boxes, and their orientation is indicated by arrows. (Adapted from Pardue et al., 1997).

A. The HeT-A and TART transposons are involved in telomere replication

The Drosophila telomeres contain arrays of two non- LTR retrotransposon-like elements called HeT-A and
TART (Rubin, 1978; Young et al., 1983; Levis et al., 1993; Danilevskaya et al., 1994; for reviews see also Mason and Biessmann, 1995; Pardue, 1995). The Drosophila telomeres (see Figure 3 for a description of their structure) seem to be extended by the addition of copies of these retrotransposons.
4

Gene Therapy and Molecular Biology Vol 4, page 5

The HeT-A and TART copies added at the ends of chromosomes are generated from RNA templates by the activity of a reverse transcriptase (see Figure 4 for a model). This mechanism of transposition has suggested that these retrotransposons could be evolutionarily related to the telomerase (Pardue et al., 1997). The Drosophila telomeres contain also other sequences called TAS (Telomere Associated Sequences) (Karpen and Spradling,
1992; Walter et al., 1995). However, all these elements are dispensable for chromosome stability during meiosis and mitosis. Chromosomes carrying terminal deletions in Drosophila have been recovered (Mason et al., 1984;
Levis, 1989). Their molecular analysis has shown that, in many cases, their ends completely lack all the normal telomere elements and that these chromosomes continue to lose terminal DNA sequences. Nevertheless, these broken chromosomes are stably transmitted through many generations as normal capped chromosomes (Biessmann et al., 1990; Levis, 1989). Occasionally, the HeT-A and TART elements transpose to the receding ends of the broken chromosomes (Biessmann et al., 1992; Biessmann et al., 1994; Sheen and Levis, 1994). These observations suggest that, in Drosophila, these elements are essential for telomere elongation (Figure 4) but dispensable for chromosome stability. Thus, unlike other organisms with telomerase-dependent telomeres, it appears that in Drosophila, while the replication function of the telomere seem to depend on specific DNA sequences, the capping function is probably attributable to one or more proteins (Biessmann et al., 1990).

B. The Heterochromatin Protein 1 (HP1) is involved in telomere capping

Recent studies have provided support for a role of HP1 in telomere capping. Indeed, it was recently shown that HP1 protein is a structural component of all Drosophila telomeres, and that, when mutated, it induced telomeric fusions, thus suggesting its functional role in telomere capping (Fanti et al.,
1998).
HP1 is a chromosomal protein which is mainly located in the heterochromatin of both polytene (James and Elgin, 1986; James et al., 1989) and mitotic (Kellum et al., 1995; Fanti et al., 1998) chromosomes of Drosophila melanogaster . Several features of this protein are already known. HP1 is a 206 amino acid protein encoded by the modifier of position effect variegation, the Su(var)205 locus (Eissenberg et al., 1990 ) (Figure 5).
A conserved amino acidic motif, called "chromo domain" has been identified in the amino-terminal region of HP1 (Paro and Hogness, 1991) and another additional domain, called "chromo shadow domain" was also identified in the carboxy-terminal region (Aasland and Stewart, 1995) (Figure

5). Both domains are likely involved in protein-protein interactions (Paro and Hogness, 1991; Aasland and Stewart,

1995). Moreover, it has been shown that the nuclear targeting activity of the protein depends on a portion of the carboxy-
terminal domain while the amino-and carboxy-terminal halves have an independent capacity to bind heterochromatin (Powers and Eissenberg, 1993; Platero et al., 1995).
A detailed cytogenetic analysis of HP1 has shown that HP1 is a stable component of all the telomeres in Drosophila, including the ends of stable terminal deletions lacking the telomeric transposons (see Figure 6 and 7 for examples) (Fanti et al., 1998).

Figure 4. Diagram showing the current view of Drosophila telomeres. Violet bars represent the HeT-A elements and orange and green bars represent the TART elements. The blue pointed bars represent the poly(A) ends by which both elements are attached to the chromosome. The transcripts of the two elements are used both as mRNAs and as templates for telomere elongation. (Adapted from Pardue et al., 1997).

5

Fanti and Pimpinelli: Organization of telomeres in Drosophila

Figure 5. Molecular structure of HP1 protein and HP1 encoding locus.

(A) Genomic map of Su(var)2-5 locus. Yellow lines represent introns while boxes represent exons. Orange boxes represent the open reading frame.

(B) Corresponding protein map of wild type HP1 with the indicated domains: the green and red boxes correspond to the chromo and chromo shadow domains, respectively. The HP1 nuclear targeting activity is restricted to about the last 58 amino acids of the carboxy- terminus while both the N- and C-terminal halves of the protein display independent heterochromatin binding activity. So far, only the carboxy-terminal half of HP1 has been shown to possess a telomere binding activity.

Figure 6. HP1 immuno-pattern on Drosophila wild type polytene chromosomes detected using the C1A9 HP1 monoclonal antibody. This protein is strongly concentrated at the chromocenter (big arrow), is present in many euchromatic regions (arrowheads) and is stably localized at all telomeres (arrows).

6

Gene Therapy and Molecular Biology Vol 4, page 7

Figure 7. HP1 immuno- pattern on mitotic chromosomes of Drosophila larval neuroblasts as revealed with the C1A9 HP1 monoclonal antibody. The protein is abundantly accumulated in the pericentric heterochromatin. Immunosignals are also present at the telomeres (arrows) and euchromatic arms. The numbers indicate the autosomes; X = X chromosome; Y = Y chromosome.

The effects of mutations in HP1 on telomere behavior were also analysed (Fanti et al., 1998). The results showed that the absence of HP1 in mutant cells causes multiple telomere-telomere fusions, resulting in a striking spectrum of abnormal chromosome configurations (Figure 8). Analysis of different metaphase and anaphase configurations has shown that the telomeric fusions induce the formation of chromosome bridges during anaphase causing extensive chromosome breakages. These fusions probably, although not exclusively, involve DNA end fusions rather than proteinaceous bridges. These observations suggested that HP1 is, most likely, a telomeric "cap" protein which is essential for telomere stability independent of the type of sequences at the chromosome termini (Fanti et al., 1998).
Another interesting gene causing telomeric fusions has been described. It has been shown that mutations of UbcD1, encoding a class I ubiquitin-conjugating (E2) enzyme, also cause frequent telomere-telomere associations during both mitosis and male meiosis in Drosophila (Cenci et al., 1997). The telomeric associations present in UbcD1 mutants are, however, resolved during mitotic anaphase and do not cause chromosome breakages, thus suggesting that in these mutants the telomeres remain associated by proteinaceous bridges rather than by DNA fusions. The most plausible explanation of these results is that the telomeres are normally associated during interphase by UbcD1 target proteins. In UbcD1 mutants the failure to degrade these proteins maintains the telomeric associations after interphase (Cenci et al., 1997).
7

Fanti and Pimpinelli: Organization of telomeres in Drosophila


Figure 8. Effect of an HP1 null-mutation on telomere stability. (A) DAPI stained neuroblastic metaphase of a wild type female larva.

(B) Ring configuration involving all the chromosomes in a neuroblast cell of HP1 mutant female larva.

(C) The same configuration as in (B) showing the HeT-A signals after in situ hybridization with the corresponding probe.

The observation that mutations to the UbcD1 locus also cause telomeric fusions raises the question of a possible functional interaction between the HP1 and UbcD1 proteins. A comparison of Su(var)2-5 and UbcD1 mutant effects seems to exclude that HP1 is a direct target of the UbcD1 enzyme. While the telomere fusions are caused by the absence of HP1, those observed in UbcD1 mutants are believed to be caused by the presence of an undegraded protein. In support of this view, we observed that HP1 is present at the telomeres of UbcD1 mutant cells (unpublished observations). Moreover, in the two mutants the telomeric fusions are differentially resolved in anaphase in that in UbcD1 mutants, the anaphasic chromosome bridges do not cause chromosome breakage (Cenci et al., 1997). Other possible explanations are suggested by a set of recent data suggesting that HP1 may also mediate the association of both the heterochromatin and telomeres with the inner nuclear membrane. It has recently been shown that the lamin B receptor (LBR), an integral protein of the inner nuclear membrane, interacts with the Drosophila HP1 in a yeast two-hybrid assay
(Shaffer et al. cited in Elgin, 1996). The same LBR protein also interacts with a human chromo domain protein homologous to Drosophila HP1 (Ye and Worman, 1996). It is not unreasonable to suppose that UbcD1 is involved in the degradation of HP1 interacting proteins, like the lamin B receptor, that mediate the ordered interaction among telomeres and/or interaction of telomeres with other structures like the inner nuclear membrane.

C. Is the telomere function of HP1 conserved?

Several studies have revealed that HP1 is a highly conserved chromosomal protein. HP1 homologues have been identified in several insect species, in plants, and in mammals, including mouse and human (Singh et al., 1991; Saunders et al., 1992; Lorentz et al., 1994; Wreggett et al., 1994; Nicol and Jeppesen, 1994; Furuta et al., 1997). Intriguingly, in mammals, the HP1 homologous proteins are similar to the Drosophila HP1 in being enriched in pericentric heterochromatin (Wreggett et al., 1994) or localized in
8

Gene Therapy and Molecular Biology Vol 4, page 9

euchromatin (Horsley et al., 1996). In particular, three HP1 like proteins were identified in human. It has been shown that one of them, the HP1Hs , is localized to the centromeres of metaphase chromosomes (Furuta et al.,
1997). From all these observations we think not
unreasonable to propose that some HP1 like proteins have conserved a functionally important telomeric localization in other species including human.
In conclusion, we think that HP1 could become a powerful starting tool to dissect the Drosophila telomeres by identification and characterization of HP1-interacting telomeric proteins. As a consequence, we believe that these approaches will permit to identify, by homology comparisons, other telomeric proteins in human cells and, thus, to make a significant contribution to the analysis of human telomere organization.

References

Aasland R, and Stewart AF (1995) The chromo shadow domain, a second chromo domain in heterochromatin-binding protein

1, HP1. Nucl Acid Res 23, 3168-3173.

Autexier C, and Greider CV (1996) Telomerase and cancer:

revisiting the telomere hypothesis. Trends Biochem Sci 21,

387-391.

Biessmann H, Carter SB, and Mason JM (1990) Chromosome ends in Drosophila without telomeric DNA sequences. Proc Natl Acad Sci USA 87, 1758-1761.

Biessmann H, and Mason JM (1992) Genetics and molecular biology of telomeres. Adv in Genet 30, 185-249.

Biessmann H, Champion LE, O’Hair M, Ikenaga K, Kasravi B, and Mason JM (1992) Frequent transposition of Drosophila melanogaster HeT-A transposable elements to receding chromosome ends. The EMBO J 11, 4459-4469.

Biessmann H, Mason JM, Ferry C, d’Hulst M, Valgeirsdottir K, Traverse KL, and Pardue ML (1994) Addition of telomere- associated HeT DNA sequences “heals” broken chromosome ends in Drosophila. Cell 61, 663-673.

Bodnar AG, Oullette M, Frolkis M, Holt SE, Chiu CP, Morin GB, Harley CB, Shay JW, Lichtsteiner S, Wright WE (1998) Extension of life-span by introduction of telomerase into normal human cells. Science 279, 349-352.

Cenci G, Rawson RB, Belloni G, Castrillon DH, Tudor M, Petrucci R, Goldberg ML, Wasserman SA, and Gatti M (1997) UbcD1, a Drosophila ubiquitin-conjugating enzyme required for proper telomere behavior. Genes and Dev 11,

863-875.

Danilevskaya O, Slot F, Pavlova M, and Pardue MM (1994) Structure of the Drosophila HeT-A transposon: a retrotransposon-like element forming telomeres. Chromosoma 103, 215-224.

de Lange T, (1995) Telomere Dynamics and genome instability in Human cancer. In Telomeres. Cold Spring Harbor Lab Press 265-293.

de Lange T, (1998) Telomeres and senescence: ending the debate. Science 279, 334-335.

Dernburg AF, Sedat J, Zacheus Cande W, Bass HW (1996) Cytology of telomeres. In Telomeres. Cold Spring Harbor Lab Press 295-338.

Elgin SCR (1996) Heterochromatin and gene regulation in

Drosophila. Curr Opin Genet Dev 6, 193-202.

Eissenberg JC, James TC, Foster-Hartnett DM, Hartnett T, Ngan V, and Elgin SCR (1990) Mutation in a heterochromatin-specific chromosomal protein is associated with suppression of position- effect variegation in Drosophila melanogaster. Proc Natl Acad Sci USA 87, 9923-9927.

Fang G, and Cech TR (1995) Telomere proteins. In telomeres. Cold

Spring Harbor Lab Press 69-105.

Fanti L, Giovinazzo G, Berloco M, and Pimpinelli S (1998) The heterochromatin protein 1 prevents telomere fusions in Drosophila. Molecular Cell 2, 527-538.

Furuta K, Chan EKL, Kiyosawa K, Reimer G, Luderschimdt C, Tan EM (1997) Heterochromatin protein HP1Hs (p25b) and its localization with centromeres in mitosis. Chromosoma 106, 11-

19.

Greider CW (1995) Telomerase biochemistry and regulation. In

Telomeres. Cold Spring Harbor Lab Press 35-68.

Harley CB (1995) Telomeres and aging. In Telomeres. Cold Spring

Harbor Lab Press 247-263.

Hazelrigg T, Levis R, and Rubin GM (1984) Transformation of white locus DNA in Drosophila: dosage compensation, zeste interaction, and position effects. Cell 36, 469-481.

Hayflick L (1965) The limited in vitro lifetime of human diploid cell strain. Exp Cell Res 37, 614-636.

Henderson E (1995) Telomere DNA structure. In Telomeres. Cold

Spring Harbor Lab Press 11-34.

Horsley D, Hutchings A, Butcher GW, and Singh PB (1996) M32, a murine homologue of Drosophila heterochromatin protein 1 (HP1), localises to euchromatin within interphase nuclei and is largely excluded from constitutive heterochromatin. Cytogenet. Cell Genet 73, 308-311.

James TC, and Elgin SCR (1986) Identification of nonhistone chromosomal protein associated with heterochromatin in Drosophila and its gene. Mol Cell Biol 6, 3862-3872.

James TC, Eissenberg JC, Craig C, Dietrich V, Hobson A, and Elgin SCR. (1989) Distribution patterns of HP1, a heterochromatin- associated nonhistone chromosomal protein of Drosophila. Eur J Cell Biol 50, 170-180.

Karpen GH, and Spradling AC (1992) Analysis of subtelomeric heterochromatin in the Drosophila minichromosome Dp 1187 by single-P element insertional mutagenesis. Genetics 132, 737-753.

Kellum R, Raff JW, and Alberts B (1995) Heterochromatin protein 1 distribution during development and during cell cycle in Drosophila embryos. J Cell Sci 108, 1407-1418.

Levis R (1989) Viable deletions of a telomere from a Drosophila

chromosome. Cell 58, 791-801.

Levis R, Hazelrigg T, and Rubin GM (1985) Effects of genomic position on the expression of transduced copies of the white gene of Drosophila. Science 229, 558-561.

Levis RW, Ganesan R, Houtchens K, Tolar LA, Sheen FM (1993) Transposons in place of telomeric repeats at a Drosophila telomere. Cell 75, 1083-1093.

Lorentz A, Osterman K, Fleck O, and Schmidt H (1994) Switching gene swi6, involved in the repression of silent mating-type loci in fission yeast, encodes a homologue of chromatin-associated proteins from Drosophila and mammals. Gene 143, 139-143.

Mason JM, and Biessmann H (1995) The unusual telomeres of

Drosophila. Trends Genet 11, 58-62.

9

Fanti and Pimpinelli: Organization of telomeres in Drosophila

Mason JM, Strobel E, and Green MM (1984) mu-2: mutator gene in Drosophila that potentiates the induction of terminal deficiencies. Proc Natl Acad Sci USA 81, 6090-6094.

McClintock B (1941) The stability of broken ends of chromosomes in Zea mays. Genetics 26, 234-282

Muller HJ (1938) The remaking of chromosomes. Collect Net 8,

182-195.

Muller HJ (1940) An analysis of the process of structural change in chromosomes of Drosophila. J Genet 40, 1-66.

Nicol L, and Jeppesen P (1994) Human autoimmune sera recognize a conserved 26 kD protein associated with mammalian heterochromatin that is homologous to heterochromatin protein 1 of Drosophila. Chromosome Res

2, 245-253.

Pardue ML (1995) Drosophila telomeres: another way to end it all. In Telomeres. Cold Spring Harbor Lab Press 339-370.

Pardue ML, Danilevskaya ON, Traverse KL, and Lowenhaupt K (1997) Evolutionary links between telomeres and transposable elements. Genetica 100, 73-84.

Paro R, and Hogness DS (1991) The polycomb protein shares a homologous domain with a heterochromatin-associated protein of Drosophila. Proc Natl Acad Sci USA 88, 263-

267.

Platero JS, Hartnett T, and Eissenberg JC (1995) Functional analysis of the chromo domain of HP1. The EMBO J 14,

3977-3986.

Powers JA, and Eissenberg JC (1993) Overlapping domains of the heterochromatin-associated protein HP1 mediate nuclear localization and heterochromatin binding. J Cell Biol 120,

291-299.

Rubin GM (1978) Isolation of a telomeric DNA sequence from Drosophila melanogaster. Cold Spring Harbor Symp Quant Biol 42, 1041-1046.

Sandell LL, and Zakian, VA (1992) Telomeric position effect in yeast. Trends Cell Biol 2, 10-14.

Sandell LL, and Zakian VA (1993) Loss of a yeast telomere:

arrest, recovery and chromosome loss. Cell 75, 729-739.

Saunders WS, Chue C, Goebl M, Craig C, Clark RF, Powers JA, Eissenberg JC, Elgin SC R, Rothfield NF, and Earnshaw WC

(1992) Molecular cloning of a human homologue of Drosophila heterochromatin protein HP1 using anti-centromere autoantibodies with anti-chromo specificity. J Cell Sci 104, 573-

582.

Shay JW, and Bacchetti S (1997) A survey of telomerase activity in human cancer. Eur J Cancer 33, 787-791.

Sheen FM, and Levis RW (1994) Transposition of the LINE-like retrotransposon TART to Drosophila chromosome termini. Proc Natl Acad Sci USA 91, 12510-12514.

Shore D (1996) Telomere Position Effects and transcriptional silencing in the yeast Saccharomyces cerevisiae. In Telomeres. Cold Spring Harbor Lab Press 139-191.

Singh PB, Miller JR, Pearce J, Kothary R, Burton RD, Paro R, James TC, and Gaunt SJ (1991) A sequence motif found in a Drosophila heterochromatin protein is conserved in animal and plants. Nucl Acids Res 19, 789-794.

Walter MF, Jang C, Kasravi B, Donath J, Mechler BM, Mason JM, Biessmann H (1995) DNA organization and polymorphism of wild-type Drosophila telomere region. Chromosoma 104, 229-

241.

van Steensel B, Smogorzewska A, and de Lange T (1998) TRF2 protects human telomeres from end-to-end fusions. Cell 92, 401-

413.

Wreggett KA, Hill F, James PS, Hutchings A, Butcher GW, and Singh PB (1994) A mammalian homologue of Drosophila heterochromatin protein 1 (HP1) is a component of constitutive heterochromatin. Cytogenet. Cell Genet 66, 99-103.

Ye Q, and Worman HJ (1996) Interaction between an integral protein of the nuclear envelope inner membrane and human chromo domain protein homologous to Drosophila HP1. J Biol Chem

271, 14653-14656.

Young BS, Pession A, Traverse KL, French C, and Pardue ML (1983) Telomere regions in Drosophila share complex DNA sequences with pericentric heterochromatin. Cell 34, 85-94

Zakian VA (1995) Telomeres: beginning to understand the end.

Science 270, 1601-1607.

Zakian VA (1996) Telomere functions: lessons from yeast. Trends

Cell Biol 6, 29-33.


Sergio Pimpinelli Laura Fanti

10