Gene Ther Mol Biol Vol 10, 165-172, 2006

 

FLT3-ITD: technical approach and characterization of cases with double duplications

Research Article

 

Emanuela Frascella*, Claudia Zampieron, Martina Piccoli, Francesca Intini, Giuseppe Basso

Laboratory of Pediatric Hematology-Oncology Unit, Department of Pediatrics, University of Padova, Italy __________________________________________________________________________________

*Correspondence: Emanuela Frascella, MD, PhD, Paediatric Haematology-Oncology Unit, Department of Paediatrics, University of Padova, via Giustiniani 3, 35128 Padova, Italy; Tel: +39-0498211455; Fax: +39-0498211462; e-mail: emanuela.frascella@unipd.it

Key words: FLT3-ITD, AML, acrylamide, purification, mutant level

Abbreviations: acute myeloid leukaemia, (AML); Internal Tandem Duplication, (ITD); tyrosine-kinase-receptor, (RTK)

 

Received: 11 January 2006; Revised: 04 April 2006

Accepted: 18 May 2006; electronically published: May 2006

 

Summary

FLT3-Internal Tandem Duplication (ITD) of the juxtamembrane domain is one of the most common genetic alterations in acute myeloid leukemia (AML) and in some FAB subgroups seems to represent an unfavorable prognostic factor. Thus, its correct identification is critical. We analyzed 261 AML cases to individuate FLT3-ITD by RT-PCR and we compare different techniques (agarose and polyacrilamide gel electrophoresis, sequence and Genescan of PCR products) to define FLT3-ITD presence, length and number. All 53 positive cases were identified by electrophoresis on agarose gel. The sequence of the FLT3-ITD amplicons eluted from polyacrilamide gel was successfully performed while failing from agarose gel. We compared different methods of purifying PCR products from polyacrilamide gel to identify the fastest and most effective one. Genescan analysis was used to confirm the presence and the length of the ITD and to study the rate between ITD/WT transcripts. In our experience electrophoresis on 2% agarose gel is adequate for identifying FLT3-ITD, while purification from polyacrilamide gel is suggested for sequencing. In our series we found 20% of positive cases, 7.5% of these lacked FLT3 wild-type transcript and 13.2% showed two different FLT3-ITDs. In addition we identify 2 cases carrying 2 FLT3-ITD with the same length but different nucleotide sequence.

 

 

I. Introduction

FLT3 is a member of the class III tyrosine-kinase-receptor-family (RTK) involved in differentiation, proliferation and apoptosis of hematopoietic cells. It is mainly expressed by early myeloid and lymphoid progenitor cells and is one of the most frequently mutated genes in Acute Myeloid Leukemia (AML). It has been detected in all AML FAB subtypes, with the highest reported frequency among M3 subtype (Rosnet et al, 1996; Abu-Duhier et al, 2001; Stirewalt and Radich, 2003). The most common type of mutation is an internal tandem duplication (ITD) of the juxtamembrane domain which is found in about 25% of AML (Stirewalt and Radich, 2003). FLT3-ITD results from a head-to-tail duplication of 3-400 base pair in exons 14 or 15 which encode the juxtamembrane domain of FLT3; they are variable in length from patient to patient, but are always in frame (Schaniptger et al, 2002). These repeat sequences cause a ligand-independent activation of the receptor and activation of a downstream signaling pathway. Some cases with both FLT3 alleles mutated and some lacking the residual wild-type allele have been described (Withman et al, 2001; Thiede et al, 2002). Patients with AML harboring FLT3-ITD mutations have a significantly greater relapse and many studies suggested that the presence of FLT3-ITD is associated with poor clinical outcome in both pediatric and adult AML patients (Kottaridis et al, 2001; Schaniptger et al, 2002; Thiede et al, 2002). Recently there has been great interest in developing FLT3-inhibitors for therapeutic use and several molecules are currently under investigation (Stirewalt and Radich, 2003). Considering prognostic and therapeutic relevance of this mutation, the standardization of methods to study FLT3-ITD seems useful. In our study, we compare the efficiency of different techniques to define FLT3-ITD presence, length and number and analyzed by sequencing all ITD found. In addition we identified a group of cases carrying more than one FLT3-ITD in which we analyzed the sequence of  ITDs and the mutant level.

 

II. Materials and methods

A. Patients

We analyzed, retrospectively, bone marrow (BM) diagnostic samples, obtained after informed consent, in a series of 261 Italian children with AML, treated at AIEOP centers between 1988 and 1998 and whose RNA were available.

 

B. RNA extraction and RT-PCR method

BM samples were centralized at diagnosis in the reference laboratory at the University of Padua. Nucleated cells were isolated by the Ficoll-Hypaque technique and frozen in liquid nitrogen. Total RNA was isolated using the RNAzol-B reagent (Tel-Test, Inc., Friendswood, TX, USA), dissolved in DEPc water and quantified with GeneQuant spectrophotometry (Pharmacia, Amersham Biosciences, Freiburg, Germany). 2 mg of total RNA were reverse transcribed using Superscriptï II (Life Technologies, Invitrogen, Milan, Italy) and random hexamers.

A PCR with ABL specific primers was performed, in each sample, to assess the presence of intact RNA and amplifiable cDNA and to exclude the presence of genomic DNA. Forward and reverse ABL primers (CCT TCT CGC TGG ACC CAG TGA and TGT GAT TAT AGC CTA AGA CCC GGA G), were located in two distinct exons. The length of PCR products derived from mRNA and DNA were 127 bp and 691 bp, respectively. Forward and reverse primers used to amplify FLT3 transcript were GCAATTTAGGTATGAAAGCCAGC and CACCTGATCCTAGTACCTTCCCA. Also these primers were located between different exons: the length of the wild-type amplicon derived from mRNA was 155 bp whilst the amplicon derived from genomic DNA was 222 bp. In each assay a sample without nucleic acid were included to verify the absence of cross contamination. PCR amplification was performed using Amplitaq polymerase (Applied Biosystem, Monza, Italy) according to the BIOMED-1 protocol. PCR reaction products were electrophoresed through 2% agarose gel and 12,5% polyacrilamide gel, and then stained with ethidium bromide (Nakao et al, 1996; Kiyoi et al, 1997; van Dongen et al, 1999).

 

C. Purification of PCR products

PCR products were processed with NucleoSpin ¨ Extract 2 in 1 (M-Medical, Milan, Italy), Microcon YM Centrifugal Filter Device (Millipore, Billerica, MA, USA) and CENTRI-SEP COLUMNS (Princeton Separation, Adelphia, NJ, USA) following manufacturerÕs instructions.

 

D. Purification of PCR products from agarose gel

FLT3-ITD and FLT3-WT bands were cut and eluted from agarose gel with NucleoSpin ¨ Extract 2 in 1 and QIAquick PCR Purification KIT (Qiagen, Milano, Italy) following manufacturerÕs instructions.

 

E. Purification of PCR products from polyacrilamide gel

Bands were excised and eluted using two different methods. Classical method (Sambrook et al, 1989) with minor modification was used in our laboratory. Briefly, gel pieces were crushed and incubate, over night at 55¡C, into microcentrifuge tube with 380 ml of elution buffer (10 mM Tris HCl pH 7.4, 0.1% SDS, 1 mM EDTA pH 8). Elution buffer were recovered, added of NaAcetate 0.3 M pH 5.4 (100 ml) and cold absolute Ethanol (1 ml), hold at –20¡C for 30 min and centrifuged at 15000 x g for 20 min at 4¡C. The supernatant was decanted and the pellet was washed in Ethanol 70% and dried. DNA recovery from polyacrilamide gel with UltrafreeŠ-MC and Amicon‰ Microcoon‰ Centrifugal Filter Devices (Millipore, Billerica, MA, USA) was performed following manufacturerÕs instructions.

Samples were dissolved in sterile water and 5 ml of eluted samples were re-amplified by PCR reactions in a 100 ml mixture using the same PCR primers and electrophoresed by 2% agarose gel. To evaluate the critical step of each method we mixed the two elution protocols in six different combinations (see results).

 

F. Genescan analysis and sequencing

All positive samples and 20 negative samples were analysed on ABI Prism 310 Genetic Analyzer after a PCR reaction with FAM5Õ labelled antisense-primer. PCR products were mixed with Genescan-500 Tamra Size Standards (Applied Biosystem, Monza, Italy) and analysed by capillar electrophoresis using POP 4 (Applied Biosystem, Monza, Italy) by Genescan analysis software. The Genescan analysis software (Applied Biosystem, Monza, Italy) was used to quantify the areas under the curves that resulted from this analysis for FLT-ITD and FLT3 wild type transcripts. The level of FLT3-ITD was expressed as a percentage of total FLT3 (wild-type plus mutated). Positive sample were sequenced using BigDyeª Terminator mix and automated sequencer ABI Prism 310 Genetic Analyzer (Applied Biosystem, Monza, Italy), according to manufacturerÕs instructions. Results of sequencing were analyzed by Chromas software and sequences were aligned with reference sequence (Z26652) by DotLET (http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html) and BLAST (http://www.ncbi.nih.gov/BLAST/).

 

III. Results and discussion

We found 53 out of 261 (20%) positive cases and 61 FLT3-ITD. All ITDs were identified using electrophoresis on 2% agarose gel in which they appeared as one or more amplicons longer than the expected product (Figure 1 A). Due to scarce availability of material 2 cases were only analysed by electrophoresis on agarose gel. All the other PCR products were electrophoresed on 12.5% polyacrilamide gel to evaluate agarose gel sensitivity and specificity in showing shortest insertions: the presence of ITD was always confirmed and we did not identify any additional positive case. It is noteworthy that, on polyacrilamide gel, all positive cases showed a specific migration pattern, including two or more products with seemingly high molecular weight in addition to wt and ITD. These bands were cut and the PCR product was eluted: its re-amplification produced both wt and ITD transcripts (Figure 1, B1 and B2) showing that these bands contain heterodimers.

The sequence of PCR products extracted from agarose gel was successfully performed for the wt transcript, but failed for the ITD amplicons in which the re-amplification show both wt and ITD products (Figure1 A1). Instead the sequence of the products eluted from polyacrilamide gel was successfully carried out for both wt and ITD transcript (Figure1 B3).

In view of the fact that sequence and Genescan analysis is required to better characterize FLT3-ITD, we compared the efficiency of different techniques to purify PCR products directly, from agarose and polyacrilamide gel, using different methods, buffers and columns. After purification, each sample was quantified by spectrophotometer to evaluate DNA recovery, re-amplificated with same primers, and sequenced with different template concentrations. Results are illustrated in Table 1.DNA recovery percentage and sequence quality was equivalent in almost all methods used to purify amplicons directly or from agarose gel. On the contrary, we observed different results in processing samples from polyacrilamide gel. Re-amplification failed using products eluted by ethanol precipitation without further purification. The two buffers used allowed a comparable DNA recovery, nevertheless the buffer with Tris-HCl required a longer incubation time than buffer with Na4+-acetate, and further salt addition for nucleic acid recovery. Ethanol precipitation needed a longer assay-time than purification by column.

We evaluated also the sequencing result after purification of PCR products. Preliminary experiments, using progressive amounts of template ranged from 10 to 80 ng, showed that better results were obtained with 25 ng of PCR product using the reverse primer (data not shown). Sequencing was successfully performed after purification of PCR products and agarose gel, while, in several cases after elution from polyacrilamide gel an additional re-amplification is required.

In our series FLT3-ITD was found in 53 out of 261 patients. Duplications ranging from 18 to 132 bp and involved the region between 1702 to 1857 nucleotides of the FLT3 reference sequence Z26652. We did not find any association between the region involved in the tandem repeat and the different FAB subtype. All ITDs were in-frame, according with other studies (Schaniptger et al, 2002; Thiede et al, 2002). In two cases ITDÕs sequence contained a portion of the intron sequence and in 12 included an insertion range between 5 and 38 nt. In 4 patients, the analysis by agarose gel showed the lack of WT transcripts, however in 3 out of 4 electrophoresis by polyacrilamide gel showed a very weak band of WT FLT3 transcript. In these 3 cases Genescan analysis identified a little peak corresponding to the WT amplicon.

Seven cases show more than one ITD (Table 2). Five were identified by agarose gel and 2 (M167 and M380) only by polyacrilamide gel. For 6 out of 7 cases there were available material for sequencing and Genescan analysis. FLT3-ITDs ranged from 21 to 99 bp, only one had an insertion of 6 bp. In 2 cases (M167 and M218) the ITDs involved different regions. In 2 cases (M375 and M380) there was a partial overlap and in  the last 2 ones (M397 and M447) the shorter ITD involved a region completely included in the longer (Figure 2). Cases M167 and M380 had two ITDs with the same length but different sequences. These cases were identified by polyacrilamide gel and confirmed by sequencing, whilst when analyzed by Genescan showed a unique peak (Figure 3, panel D). In this group the total level of mutants detected ranged from 12.5% to 90.2%. In 3 cases the values were compatible with a heterozygous mutation in all or the majority of cells; in case M397 results suggested the lack of wild-type transcript, while in the other two cases data suggested the presence of mutation in a cell sub-clone.

 

Figure 1. Electrophoresis on agarose and polyacrilamide gels. Patients are identified by number. First line molecular weight markers. Panel A: agarose gel. Panel A1: re-amplification after elution of ITD amplicon generates both ITD and wild-type products. Panel B: polyacrilamide gel. Panel B1 and B2: electrophoresis on agarose (B1) and polyacrilamide (B2) after elution and re-amplification of the amplicon with seemingly high molecular weight. The re-amplification generates both ITD and wild-type products.  Panel B3: re-amplification after elution of ITD amplicons generates only ITD product.

Table 1. Evaluation of different methods of PCR product purification. Assay-time, DNA recovery and quality of re-amplification and sequence were evaluated for each method. PCR elution from polyacrilamide gel was performed using two different buffers: *Buffer 10 mM TRIS HCl pH 7.4, 0.1% SDS, 1 mM EDTA pH 8; ^Buffer 0.5 M NH4+ Acetate, 2 mM EDTA pH 8, 0.1% SDS.

 

 

#

Purification Method

Assay

Time

% DNA

recovery

Re-amplification

Source of amplicon
1

No purification

0

100

+

PCR product

2

Nucleospin Extract (M-Medical Cat. N. 740-590-250)

60 min

9

+

3

Microcon YM Centrifugal Filter Device (Millipore Cat N. 42413)

20 min

8

+

4

Centri-Sep Columns (Priceton Separations Cat. N. CS-901)

150 min

9

+

Agarose gel

5

Nucleospin Extract (M-Medical Cat. N. 740-590-250)

90 min

11

+/-

6

QIAquick PCR purification Kit (Qiagen Cat. N. 28180)

120 min

8

+

Poliacrylammide gel

7

Elution buffer with Tris-HCl*, Ultrafree–MC 0.45 mm (Millipore Cat N. UFC3 0HV 0S) for polyacrilamide residues

750 min

 

2

+

8

Elution buffer with Tris-HCl*, ethanol precipitation.

890 min

8

-

9

Elution buffer with Tris-HCl *, ethanol precipitation, purification with Microcon YM

910 min

2

+

10

Elution buffer with ammonium acetate^, ethanol precipitation

270 min

4

-

11

Elution buffer with ammonium acetate^, ethanol precipitation, purification with Microcon YM

290 min

2

+

12

Elution buffer with ammonium acetate^, Ultrafree–MC 0.45 mm for polyacrilamide residues, purification with Microcon YM

155 min

4

+

 

 

Table 2. Cases with double FLT3-ITD

 

N.

 Pts.

FLT3-ITD

sequence

FLT3-ITD

length

(insertion)

Genescan

 analysis

ITD/WT+ITD

M167

1705-1725

21

Unique peak

12.5%

 

1777-1797

21

M218

1714-1779

66

12%

 

1789-1812

24

52%

M300

not done

 

not done

 

not done

 

not done

M375

1798-1839

42

(6 nt)

27%

 

1786-1806

21

18.5%

M380

1768-1788

21

Unique peak

41%

 

1777-1797

21

M397

1738-1836

99

86.5%

 

1774-1794

21

3.7%

M447

1756-1833

78

13 %

 

1798-1827

30

13.5%

We analyzed also the level of each mutant in the 4 cases in which the internal tandem duplications were different in length. In two cases (M218 and M397) the strong difference of the mutant level suggested the presence of  two different mutant clones. In the others we did not able to exclude a unique sub-clone in which the WT FLT3 transcript was lacked. In conclusions, in our experience electrophoresis on agarose 2% gel showed excellent sensitivity and specificity in the identification of the FLT3-ITD and shorter ITD were never found, even after capillary electrophoresis analysis. The use of polyacrilamide gel is suggested to isolate the ITD amplicons for sequencing, due to their strong propensity in forming heterodimers with the WT amplicon. Purification of PCR products is useful to sequence amplicons. Methods tested to purify PCR products directly or from agarose gel were equivalent. Thus, the method chosen could be based on cost and time-assay. On the contrary, purification from polyacrilamide can be very laborious and poorly effective: in our experience elution by Ultrafree-MC column with NH4+-acetate buffer, followed by a further purification by

 

Figure 2. Representation of the internal tandem duplication found ordered by sample. Colors identified different patients. Group 1 red and green. Group 2 orange and blue. Group 3 pink and yellow.

 

 

 

 

 

 

 

 

 

 

Figure 3. Upper: Sequence and scheme of 4 exemplificative samples. White-boxes: exons; black-boxes: tandem duplication; square-box: intron fragment. ITDs are highlighted in bolded character and are underlined together with the previous exonic similar sequence. Lower: Genescan electropherograms of the same samples. Red line molecular weight markers, blue line PCR products. White arrows indicate wild-type amplicon peak, black arrows point to ITD peaks. Panel A: normal peripheral blood. Panel B: sample #400 with a 18 bp ITD. Panel C: sample #447 with two ITDs of 30 and 81 bp, respectively. Panel D: sample #380. This sample had two ITD with the same length (21 bp) but Genescan analysis was not able to discriminate them. Panel E: sample #089 with a very small peak corresponding to the ITD.

Microcon-YM column, represents the most effective and fast method (Table 1 number 12).

The Genescan analysis allowed for the identification of normal and mutated transcripts even if present in very low amounts. In addition it allowed the study of mutant level.

In our series 20% of AML carried an FLT3-ITD and according with previous report all the internal tandem duplication found were in-frame. The high frequency of FLT3-ITD could be due to the retrospective nature of the study (Frascella et al. 2004) and the high number of acute promyelocytic leukaemia (52/261). In contrast with data regarding adult population (Withman et al, 2001), in our paediatric series the absence of the WT transcript seems to be very rare. In 3 out of 4 cases a low quantity of WT FLT3 transcript was found but we suppose that this small amount could originate from residual bone marrow normal cells.

Finally we individuate a subset of patients carrying more than one FLT3-ITD. Among these cases we identify 2 cases carrying two internal tandem duplications with the same length but different nucleotide sequence. These cases were discovered by polyacrilamide gel because the ITDs appeared as a unique band on agarose gel and as a unique peak with the Genescan analysis. It is to note that, in this group, only in one case the lack of WT FLT3 might suggest lost of heterozygosity or biallelic mutation. In these patients the structure of the couple of  ITDs found could be classify in 3 group based on the region involved in the duplication: group 1- different ITDs (M167, M218); group 2 - partially overlapped ITDs (M375, M380); group 3 - completely overlapped ITDs, in which all the nucleotide involved in the shorter one are included also in the longer (M397, M447) (Figure 2). Until now no definitive hypothesis regarding FLT3-ITD origin exists. Some authors suggested that binding sites for Topoisomerase II, identified in the region interested by duplication, could cause breaks to double strand of the DNA (Libura et al, 2003). These breaks are normally repaired by either non-homologous or homologous repair systems. In some AML a decreased efficiency of the not-homologous repair system has been reported (Gaymes et al, 2002; Zhong et al, 1999), and it could contribute to the creation of the FLT3-ITD in consequence of the loop formation, (Kiyoi et al, 1998). In our series we could hypothesize different mutation in group 1  patients cases while an evolution of the first mutation could be suggested in group 2 and 3 cases.

 

Acknowledgments

We thank Dr C. Case for manuscript preparation. This research was supported by Fondazione Cittˆ della Speranza and AIL.

 

References

Abu-Duhier FM, Goodeve AC, Wilson GA, Care RS, Peake IR, Reilly JT (2001) Genomic structure of human FLT3: implication for mutational analysis. Br J Haematol 113, 1076-1077.

Frascella E, Rondelli R, Pigazzi M, Zampieron C, Fagioli F, Favre C, Lippi AA, Locatelli F, Luciani M, Menna G, Micalizzi C, Rizzari C, Testi AM, Pession A, Basso G (2004) Clinical features of childhood acute myeloid leukaemia with specific geneRearrangements. Leukemia 18, 1427-1450.

Gaymes TJ, Mufti GJ, Rassool FV (2002) Myeloid leukemias have increased activity of the nonhomologous end joining pathway and concomitant DNA misrepair that is dependent on the Ku70/86 heterodimer. Cancer Res. 62: 2791-2797.

Kiyoi H, Naoe T, Yokota S, Nakao M, Minami S, Kuriyama K, Takeshita A, Saito K, Hasegawa S, Shimodaira S, Tamura J, Shimazaki C, Matsue K, Kobayashi H, Arima N, Suzuki R, Morishita H, Saito H, Ueda R, Ohno R (1997) Internal tandem duplication of the FLT3 associated with leukocytosis in acute promyelocytic leukemia. Leukemia Study Group of the Ministry of Health and welfare (Kohseisho). Leukemia 11, 1447-1452.

Kiyoi H, Towatari M, Yokota S, Hamaguchi M, Ohno R, Saito H, Naoe T (1998) Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product. Leukemia 12, 1333-1337.

Kottaridis PD, Gale RE, Frew ME, Harrison G, Langabeer SE, Belton AA, Walker H, Wheatley K, et al (2001) The presence of an internal tandem duplication in patients with acute myeloid leukemia (AML) adds important prognostic information to cytogenetic risk group and response to the first cycle of chemotherapy: analysis of 854 patients from the United Kingdom Medical Research Council AML 10 and 12 trials. Blood 98, 1752-1759.

Libura M, Asnafi V, Tu A, Delabesse E, Tigaud I, Cymbalista F, Bennaceur-Griscelli A, Villarese P, Solbu G, Hagemeijer A, Beldjord K, Hermine O, Macintyre E (2003) FLT3 and MLL intragenic abnormalities in AML reflect a common category of genotoxic stress. Blood 102, 2198-2204.

Nakao M, Yokota S, Iwai T, Kaneko H, Horiike S, Kashima K, Sonoda Y, Fujimoto T, Misawa S (1996) Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia 10, 1911-1918.

Rosnet O, Buhring HJ, Marchetto S, Rappold I, Lavagna C, Sainty D, Arnoulet C, Chabannon C, Kanz L, Hannum C, Birnbaum D (1996) Human FLT3/FLK2 receptor tyrosine kinase is expressed at the surface of normal and malignant hematopoietic cells. Leukemia 10, 238-248.

Sambrook J, Fritsh EF, and Maniatis T (1989) Molecular Cloning, a laboratory manual. Cold Spring Harbor Laboratory Press, New York, USA.

Schnittger S, Schoch C, Dugas M, Kern W, Staib P, Wuchter C, Loffler H, Sauerland CM, Serve H, Buchner T, Haferlach T, Hiddemann W (2002) Analysis of FLT3 length mutations in 1003 patients with acute myeloid leukemia: correlation to cytogenetics, FAB subtype, and prognosis in AMLCG study and usefulness as a marker for the detection of minimal residual disease. Blood 100, 59-66.

Stirewalt D and Radich JP (2003) The role of FLT3 in haematopoietic malignancies. Nat Rev Cancer 3, 650-665.

Thiede C, Steudel C, Mohr B, Schaich M, Schakel U, Platzbecker U, Wermke M, Bornhauser M, Ritter M, Neubauer A, Ehninger G, Illmer T (2002) Analysis of FLT3-activating mutations in 979 patients with acute myelogenous leukemia: association with FAB subtype and identification of subgroups poor prognosis. Blood 99, 4326-4335.

van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V, Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F, Parreira A, Gameiro P, Diaz MG, Malec M, Langerak AW, San Miguel JF, Biondi A (1999) Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia Leukemia 13, 1901-1928

Whitman SP, Archer KJ, Feng L, Baldus C, Becknell B, Carlson BD, Carroll AJ, Mrozek K, Vardiman JW, George SL, Kolitz JE, Larson RA, Bloomfield CD, Caligiuri MA (2001) Absence of the wild type allele predicts poor prognosis in adult de novo acute myeloid leukemia with normal cytogenetics and internal tandem duplication of FLT3: a cancer and leukemia group B study. Cancer Res 61, 7233-7239.

Zhong S, Hu P, Ye TZ, Stan R, Ellis NA, Pandolfi PP (1999) A role for PML and the nuclear body in genomic stability. Oncogene 18, 7941-7947.

 

 

 

 

From the top to the bottom and from the left to right: Emanuela Frascella, Claudia Zampieron, Martina Piccoli, Francesca Intini, Giuseppe Basso