Gene Ther Mol Biol Vol 10, 161-164,
2006
Medicine faculty of Shaheed Beheshti Medical sciences
of IRAN & Infectious Diseases & Tropical Medicine Research Center of
SBMU of Iran
__________________________________________________________________________________
*Correspondence: Hossein Goudarzi, School of Microbiology, Modif Hospital, Shaheed, Beheshti,
University, Tehran-Iran; e-mail:
hgod100@yahoo.com
Key words: 16srRNA, meningitis
Abbreviations: cerebrospinal
fluid, (CSF)
Summary
In order to treatment of patients with meningitis
rapid diagnosis of agent is very important. Now all of researchers have
approved qualification and efficiency of molecular tests. Detection of bacteria
from cerebrospinal fluid (CSF) and blood is big cumbersome as atmosphere
condition and usage of antibiotics by patients. We explored on CSF samples by
PCR test and used DG74 and RDR80 primers for 16S rDNA sequence. Our cases are
children with meningitis symptoms that had referred to hospitals at Tehran.
This samples are different from culture, cell counter and protein glucose
amounts. After researching we reached to these results that 23.5% of case were
positive as bacterial culture and 41.1% of them were positive as PCR test. So
sensitivity of PCR was95.23%, specificity of PCR was 96.66% and efficiency of
PCR was 96%.
Rapid identification of bacterial meningitis is very
important. Now, Isolation of bacteria from CSF or blood in 24 hours incubation
is routine method, but some bacteria are fastidious, some patients have received
antibiotic before sampling, so culture will be negative. Growth of bacteria depends on sampling and transfer
condition too. Treatment of cell culture for identifying of viruses in some
sample is very troublesome, expensive and requires to long time. Therefore we
need a sensitive method to solve above problems. Meningitis is an acute
life–threatening infection. The mortality rate is approximately 10-15%
(depending on the bacteria involved), even with appropriate anti microbial
therapy. The incidence of disease
decreases with age. The prevalence of a particular etiologic agent is also
related to patients ago. Clinical manifestations vary considerably depending on
the virolence of the organism and the age of patient. In neonates the signs of
meningeal irritation (neckal rigidity and Brudzinski and Kernigs signs are
infrequent and often minimal when found early signs include temperature
instability, poor feeding and vomiting.
In children 1-18 month of age signs and symptoms are
often nonspecific and include fever, irritability, drowziness, Vomiting, poor
feeding, crying when handled, bulging fontanels (due to increased intravascular
pressure) and febrile seizures. So, rapid identification is very impotant.
Chemical tests and cell count of CSF in bacterial and viral meningitis is not
100% specific. The molecular methods in identification of microorganisms in
clinical specimens have developed. One of these methods is PCR, we can use
aseptic primer to multiply of unknown DNA. In our research we used 16S rDNA gene
sequence for PCR. As 16srRNA sequence was constant during the evolution than to
23s and 5srRNA and approximately is identical in all of prokaryotes.
This research is descriptive. Sampling is done in
Tehran pediatric hospitals from children with meningitis. Sampling method was
lumbar puncture. All of tests such as bacteriologic, biochemistry cell count
and PCR was done on sample in sterile condition. 200 ml of each sample
in a micro tube is kept in -20ΓC. On remaining of CSF, the first is done
gram staining, bacterial culture, cell count with hematocytometer, cell typing,
considering protein and Glucose.
Bacteriologic culture is blood agar, EMB and chocolate
agar In PCR we use 2 type primers that are specific for 16S rRNASequence:
DG 74: AGGAGGTATCCAACCGCA
RDR 80: AACTGGAGGAAGGTGGGGAG
PCR is done in Automatic Thermocycler.
PCR has 3 process:
i.
Denaturation in 94ΓC
ii.
Annealing in 60ΓC
iii. Extension in 72 ΓC
These processes are repeated 30- 35 times. For each
sample in micro tube, we use dNTP mixture, PCR buffer, MgCl2, 2pair
primers, Taq polymerase and production of PCR electrophoresis on 2% gel.
Finding a rapid and
specific test for identifying of bacterial meningitis, 51 CSF samples from
children under 6 years in Mofid hospital from July to March were received
44.7%.
Patients with meningitis were suspected to meningitis, 55.3% were negative for PCR. 34.2% of 44.7% suspected to bacterial meningitis and 10.5% suspected to viral meningitis.
We studied about culture, cell count of CSF in children with meningitis that has been shown in Table 1.We found the positive culture of CSF in children with meningitis was 23.5%, Table 2.We resulted the frequency of positive PCR in CSF of children with meningitis 41.1%, Table 3.
In this research, we use 16srRNA gene sequences of
bacterial to identify bacterial infection on CSF specimens from children who
refer to Tehrans hospitals. David Fredrics in 1999, used PCR method and 16srRNA
sequence in sterile specimens such as blood, spinal fluid, specificity and
sensitivity was more than 97% In 1998 Dagan et al, used PCR for identifying DNA
of pneumococci in children and sera. Blood culture was positive 30% and
sensitivity of PCR was 100%. In 1997 Tang et al, used this method for
identifying of infectious disease such as gold standard. In 1996 Newcombe et
al, used PCR for identifying meningococci in peripheral blood. In 1993 Greisen
et al, used PCR for identifying of 102 bacteria species. Specificity and
sensitivity was more than 96%. It is important to know that sterile fluid such
as patient speciment that treatment with antibiotic, number of bacteria were
low, some of bacteria were fastidious and need to an enrichment media and
specific atmosphere, (for example CO2 or anaerobic) and some of this
bacteria Sensitive to transport conditions. Therefore, we can t identify all of
bacteria by culture and isolation of bacteria and we can t reach to desire
results.
In first group 8 speciment were positive PCR (88.8%).
In second group, all of 12 specimens were positive PCR (100%).
|
Method (%) |
Cell count in LP |
Culture |
Manifestation of meningitis |
|
|
9 12 8 22 |
10.7 23.5 10.5 55.3 |
N > L N > L L > N ---- |
---- Meningococcus Pneumococcus Haemophilus influenza
---- ---- |
+ + + + |
|
51 |
100 |
N: Neutrophil, L: Lymphocyte |
||
Table 2. The frequence of positive calture in
children with meningitis refer to Mofid hospital in 2000.
|
Frequent Culture |
Number |
Percent |
|
Positive |
12 |
23.5 |
|
Negative |
39 |
46.5 |
|
Total |
51 |
100 |
23.5% of 51
specimens suspected to bacterial meningitis.
Table 3.
The frequency of positive PCR in CSF of children with meningitis refer to Mofid
hospital
|
PCR |
Number |
Percent |
|
Positive |
21 |
41.1 |
|
Negative |
30 |
58.9 |
|
Total |
51 |
100 |
In third, 8 specimens suspected to viral meningitis, only one case was positive PCR, so it had bacterial agent. In fourth group, all of 22 specimens were negative PCR. There fore sensitivity and spesitivity of PCR test with 16S rDNA A gene sequence in identification of bacterial agent in CSF was 95.23% and 96.66%.
Dagan R, Shriker O, Hazan I, Leibovitz E, Greenberg D,
Schlaeffer F, Levy R (1998)
Prospective study to determine clinical relevance of detection of pneumococcal
DNA in sera of children by PCR. J Clin Microbiol 36, 669-73.
Fredricks DN, Relman DA (1998) Improved amplification of microbial DNA from blood
cultures by removal of the PCR inhibitor sodium polyanetholesulfonate. J
Clin Microbiol 36, 2810-6.
Fredricks DN, Relman DA (1999) Application of polymerase chain reaction to the
diagnosis of infectious diseases. Clin Infect Dis 29, 475-86.
Gelfand DH and White TJ (1998) In: PCR Protocols: A Guide to Methods and
Applications, Innis MA, Gelfand DH, Sninsky JJ and White TJ, eds, Academic
Press, San Diego, CA,
Greisen K, Loeffelholz M, Purohit A, Leong D (1994) PCR primers and probes for the 16S rRNA gene of most
species of pathogenic bacteria, including bacteria found in cerebrospinal
fluid. J Clin Microbiol 32,
335-351.
Harrisonn S (1998) Principal of internal medicine, 14ed. Vol 2 MC Grow. Hill company,
2419-2426.
Newcombe J, Cartwright K, Palmer WH, McFadden J (1996) PCR of peripheral blood for diagnosis of
meningococcal disease. J Clin Microbiol 34,1637-40.
Read SJ, Jeffery KJ, Bangham CR (1997) Aseptic meningitis and encephalitis: the role of PCR
in the diagnostic laboratory. J Clin Microbiol 35, 691-6.
Snyder L, Champness W (1997) Molecular genetics of bacteria ASM, Washington DC.
Stein JH (1998) Stein's Internal Medicine, 3th ed., John J. Hutton, John H. Klippel,
Peter O. Kohler, Nicholas F. Larusso, John M. Eisenberg (Editor), 1281-1291.
Tang YW, Procop GW, Persing DH (1997) Molecular diagnostics of infectious diseases. Clin
Chem 43,2021-2038.
Wiffiam J, Hauster Jr (1998) Max Sussman, Microbiology and Microbial infections,
9ed.